Mathematics

Mathematics, 15.06.2021 17:40, olivasm5626

How many times can a length of 0.3 m be cut from a string 3.66 m long

answer

Answers: 2

Show answers

Other questions on the subject: Mathematics

Mathematics, 21.06.2019 16:30, aperez4102

What is the order of magnitude for the number of liters in a large bottle of soda served at a party

Answers: 2

Mathematics, 21.06.2019 19:30, ruddymorales1123

If y varies directly as x2 and y=6 when x=6, find the constant of variation.

Answers: 2

Mathematics, 21.06.2019 21:30, bryantfoster

Helll ! 1,400 tons of wheat of two different varieties was delivered to the silo. when processing one variety, there was 2% of waste and 3% during the processing of the second variety of wheat. after the processing, the amount of remaining wheat was 1,364 tons. how many tons of each variety of wheat was delivered to the silo?

Answers: 1

Mathematics, 22.06.2019 00:20, sdwhitneyhillis

Which shows how to solve the equation 3/4x=6 for x in one step?

Answers: 2

Do you know the correct answer?

How many times can a length of 0.3 m be cut from a string 3.66 m long...

Questions in other subjects:

Konu

Mathematics, 02.08.2019 17:00

Answer will mark the total capacity of 6 pitchers and 12 glasses is 21 liters. the capacity of a pitcher is 5 times that of a glass. find the capacity of each glass. give your ans...

Konu

Social Studies, 02.08.2019 17:00

What did alaska and hawaii have in common in the late 1800s? a) both areas are islands in the pacific ocean. b) both areas were far from most of the american population. c) both a...

Konu

Mathematics, 02.08.2019 17:00

Ineed like now ! simplify the expression : 7y + 3x + 3 - 2y + 6 what is the coefficient of y? what is the constant?...

Konu

Biology, 02.08.2019 17:00

What are pelvic bones in snakes an example of...

Konu

Biology, 02.08.2019 17:00

To which of the following dna sequences would the tata box binding protein bind? a. taggcgtatatagcgccttat b. cccgttaattaattaacgcgc c. gcgcttatctattaccgtacg d. atcgattccgatacta...

Konu

English, 02.08.2019 17:00

What is professor moriarty’s relationship with holmes?...

Konu

Health, 02.08.2019 17:00

Aclient can be: a: to move up the bed by two care workers holding each other’s wrists and lifting the client under the back and thighs b: turned in bed by one care worker placi...

Konu

Mathematics, 02.08.2019 17:00

30 seconds slower than godfrey's time algebraic expression...

Konu

Mathematics, 02.08.2019 17:00

Explain how to solve the problem below. in your response, you must analyze the given information, discuss a strategy or plan to solve the problem, determine and justify a solution,...

Konu

Mathematics, 02.08.2019 17:00

What is 5 to the second power plus 2 the the fifth power plus 1...

Other tasks in the category: Mathematics More task