To which of the following dna sequences would the tata box binding protein bind? a. taggcgtatatagcgccttat b. cccgttaattaattaacgcgc c. gcgcttatctattaccgtacg d. atcgattccgatactatgcta

In one or two well-crafted paragraphs in your laboratory journal, summarize the process in which normal cells become cancer cells. your paragraph(s) must include each of the terms listed below. underline each term in your writing:

This is an active transport mechanism by which cells pump sodium and potassium ions against the concentration gradient

Which of these is not an example of molecular homology? 1. use of dna and rna as genetic material 2.use of glycolysis as the first step in cellular respiration in both plants and animals 3. the lack of an igf-1 gene in prokaryotes 4. the use of aldolase b to break down fructose in bacteria, plants and animals