Mathematics

Mathematics, 23.04.2020 10:47, bargasdevon123

18: Please help. What is the perimeter of △ABC?

18: Please help. What is the perimeter of △ABC?

answer

Answers: 3

Show answers

Other questions on the subject: Mathematics

Mathematics, 21.06.2019 18:30, aghalyaa

Find the values of y: 3y^3(y^2+ 2/3y)=0

Answers: 2

Mathematics, 21.06.2019 23:30, SmolBeanPotato

If the perimeter of the garden is 37 ft. the width is x and the length is 15 ft. what is the width of the garden in feet?

Answers: 2

Mathematics, 22.06.2019 04:20, quintonps12

Which math statement does not contain a math variable ?

Answers: 1

Mathematics, 22.06.2019 04:30, jgpjessi1854

Fran has 7 sheets of paper for a coloring project. if she only uses 1/3of a sheet of paper per draing how many drawings can ahe make?

Answers: 1

Do you know the correct answer?

18: Please help. What is the perimeter of △ABC?
...

Questions in other subjects:

Konu

Computers and Technology, 10.03.2020 08:08

A(n) is a calculation (using encryption technologies) based on the contents of a disk or file. They are engineered so that even small changes in the source data will produce signi...

Konu

Physics, 10.03.2020 08:08

An airplane speeds down a runway lined by red and green lights as it prepares for takeoff. In the distance, the parallel red and green lights appear to converge. This is BEST expla...

Konu

Social Studies, 10.03.2020 08:08

Many different approaches have been suggested to aid the analyst in identifying a set of candidate objects for the structural model. The four most common approaches are textual ana...

Konu

Business, 10.03.2020 08:08

An angry customer has emailed Kurtis wanting to know why the custom luggage he ordered three weeks ago hasn't arrived yet. When Kurtis looks up the order, he discovers that the cus...

Konu

Biology, 10.03.2020 08:08

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 8C. If an RNA dup...

Konu

Business, 10.03.2020 08:08

You own 400 shares of Stock A at a price of $60 per share, 500 shares of Stock B at $85 per share, and 900 shares of Stock C at $25 per share. The betas for the stocks are 0.8, 1.2...

Konu

Mathematics, 10.03.2020 08:08

Choose the correct problem formulation: A Statistics Department is contacting alumni by telephone asking for donations to help fund a new computer laboratory. Past history shows th...

Konu

Business, 10.03.2020 08:08

River Thames Insurance Company plans to sell $2,000,000 of euro-commercial paper with a 60-day maturity and discounted to yield 4.60% per annum (assume 60-day (or two month) compou...

Konu

Social Studies, 10.03.2020 08:08

Assume that the union wage already exceeds the market-clearing wage. If the union wage is increased, holding other factors constant, then the number unemployed and the number empl...

Konu

Business, 10.03.2020 08:08

In which type of operations are you likely to see, at most, only minor variations in the product or service being produced using the same process and the same equipment?...

Other tasks in the category: Mathematics More task