Biology, 10.03.2020 08:08, OrionGaming

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?

Answers: 3

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 05:30, angelesramos112

One important development during the 3rd trimester that will insulate the infant against changes in temperature is a. the deposition of fat under the skin b. the closing of the septum between c. the atria of the heart d. the beginnings of lung functioning e. the beginnings of light and sound sensing

Answers: 3

continue

Biology, 22.06.2019 06:20, justinb0829

Select the correct answer from each drop-down menu proteins are

Answers: 1

continue

Biology, 22.06.2019 10:20, saucyyyyniahhhhh

Aquaternary consumer species would be expected to have a smaller population than a secondary consumer species. select the best answer from the choices provided t f

Answers: 1

continue

Biology, 22.06.2019 16:00, live4dramaoy0yf9

Collin would like to use the data a coworker has entered in a database. the problem is the coworker's database software is different from collin's. collin should

Answers: 3

continue

Do you know the correct answer?

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequ...