Mathematics

Mathematics, 07.03.2020 03:41, KariSupreme

+
Which equation is equivalent to y = x + 24x – 18?
1) y =(x + 12)2 – 162
2) y = (x + 12)? +126
3) y = (x - 12) – 162
4) y = (x – 12)+ 126

answer

Answers: 3

Show answers

Other questions on the subject: Mathematics

Mathematics, 21.06.2019 16:30, andybiersack154

If 20% of a number is 35, what is 50% of that number?

Answers: 2

Mathematics, 21.06.2019 17:40, faithtunison

Aline has a slope of and a y-intercept of –2. what is the x-intercept of the line?

Answers: 1

Mathematics, 21.06.2019 19:10, teriateria

If you answer 2+2 you will get over 80 points

Answers: 2

Mathematics, 21.06.2019 19:30, sk9600930

Sundar used linear combination to solve the system of equations shown. he did so by multiplying the first equation by 5 and the second equation by another number to eliminate the y-terms. what number did sundar multiply the second equation by? 2x+9y=41 3x+5y=36

Answers: 1

Do you know the correct answer?

+
Which equation is equivalent to y = x + 24x – 18?
1) y =(x + 12)2 – 162
2) y = (...

Questions in other subjects:

Konu

Physics, 05.11.2020 18:40

A 10 kg object is subjected to two forces F1 and F2. F1 has a magnitude of 20 N and acts straight upward and F2 has a magnitude of 30 N at 30 degrees below the horizontal from the...

Konu

Biology, 05.11.2020 18:40

Below is a partial mRNA sequence. Use it to answer the following questions. 5' - UGGUCGGCGAGAACGAAAGCGC - 3' Encoded within the partial mRNA sequence is a region of the pro...

Konu

Biology, 05.11.2020 18:40

How do acacia trees communicate with each other in response to insect attack? A) They produce a gas called ethylene. B) They release pollen. C) They produce thorns and...

Konu

Mathematics, 05.11.2020 18:40

I need help with these too ...

Konu

Mathematics, 05.11.2020 18:40

Drag and drop the expressions into the boxes to correctly complete the proof of the polynomial identity.(x^2-y^2)^2+x^4+y^4=2(x^4- x^2y^2y^4)...

Konu

Physics, 05.11.2020 18:40

Cfare nxitimi shkakton forca F=40N, qe vepron neme mase m=10kg??...

Konu

Mathematics, 05.11.2020 18:40

Use approximation to find the square root to the nearest hundredth. 131...

Konu

Mathematics, 05.11.2020 18:40

Please help and add steps i’m stuck :( ...

Konu

Business, 05.11.2020 18:40

Savvy Sightseeing had beginning equity of $72,000; revenues of $90,000, expenses of $65,000, and dividends to stockholders of $9,000. There were no stockholder investments during t...

Konu

Chemistry, 05.11.2020 18:40

“What ion does Magnesium (Mg) become?” A. Mg1- B. Mg2- C. Mg1+ D. Mg2+...

Other tasks in the category: Mathematics More task