Biology, 05.11.2020 18:40, jayjay2006

Below is a partial mRNA sequence. Use it to answer the following questions. 5' - UGGUCGGCGAGAACGAAAGCGC - 3'
Encoded within the partial mRNA sequence is a region of the protein with the amino acid sequence (N-term...G-E-N-E-S...C-term).
What is the correct reading frame for this mRNA? (Note that the reading frame may not begin with the first base in the partial sequence. It may be necessary to view codons further downstream to find the amino acid sequence N-term...G-E-N-E-S...C-term.)
1. 5' - U | GGU | CGG | CGA | GAA | CGA | AAG | CGC | - 3'
2. 5' - | UGG | UCG | GCG | AGA | ACG | AAA | GCG | C - 3'
3. 5' - UG | GUC | GGC | GAG | AAC | GAA | AGC | GC - 3'
4. 5' - UGGU | CGGC | GAGA | ACGA | AAGC | GC - 3'

Answers: 1

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 23:30, ciara180

What is a traditional chinese touch therapy involving finger pressure applied to specific areas of the body to restore the flow of qi.

Answers: 1

continue

Biology, 22.06.2019 03:50, Jeyson5852

How are gross production and net production different? a. net production is always greater than gross production. b. net production is always less than gross production. only animals have net production. d. only plants have net production. select the best answer from the choices provided

Answers: 1

continue

Biology, 22.06.2019 08:20, BluedragonKBT44

10111213141516lactic acid fermentation differs from ethyl alcohol fermentation in thato in ethyl alcohol fermentation co2 is also producedlactic acid fermentation can occur in all living thingsethyl alcohol fermentation can only occur in plantsonly lactic acid fermentation can produce more atp

Answers: 1

continue

Biology, 22.06.2019 10:30, julih74

Why is taking care of yourself a time management techique

Answers: 1

continue

Do you know the correct answer?

Below is a partial mRNA sequence. Use it to answer the following questions. 5' - UGGUCGGCGAGAACGAAA...