![Biology](/tpl/images/cats/biologiya.png)
Biology, 05.11.2020 18:40, jayjay2006
Below is a partial mRNA sequence. Use it to answer the following questions.
5' - UGGUCGGCGAGAACGAAAGCGC - 3'
Encoded within the partial mRNA sequence is a region of the protein with the amino acid sequence (N-term...G-E-N-E-S...C-term).
What is the correct reading frame for this mRNA? (Note that the reading frame may not begin with the first base in the partial sequence. It may be necessary to view codons further downstream to find the amino acid sequence N-term...G-E-N-E-S...C-term.)
1. 5' - U | GGU | CGG | CGA | GAA | CGA | AAG | CGC | - 3'
2. 5' - | UGG | UCG | GCG | AGA | ACG | AAA | GCG | C - 3'
3. 5' - UG | GUC | GGC | GAG | AAC | GAA | AGC | GC - 3'
4. 5' - UGGU | CGGC | GAGA | ACGA | AAGC | GC - 3'
![answer](/tpl/images/cats/otvet.png)
Answers: 1
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:50, Jeyson5852
How are gross production and net production different? a. net production is always greater than gross production. b. net production is always less than gross production. only animals have net production. d. only plants have net production. select the best answer from the choices provided
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:20, BluedragonKBT44
10111213141516lactic acid fermentation differs from ethyl alcohol fermentation in thato in ethyl alcohol fermentation co2 is also producedlactic acid fermentation can occur in all living thingsethyl alcohol fermentation can only occur in plantsonly lactic acid fermentation can produce more atp
Answers: 1
Do you know the correct answer?
Below is a partial mRNA sequence. Use it to answer the following questions.
5' - UGGUCGGCGAGAACGAAA...
Questions in other subjects:
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/himiya.png)
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 29.01.2020 23:46
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 29.01.2020 23:46
![Konu](/tpl/images/cats/biologiya.png)