Biology
Biology, 27.07.2019 16:30, 3ittylilbiddy3

In a population of brown snakes, a snake is born with a white-spotted pattern. which factor will have the most influence on whether this trait will become common in the brown snake population? a) the history of the pattern in previous snake populations b) the ability of the snake to survive to reproduce c) the appearance of other new traits in the baby snake d) the presence of thermal energy changing the snake pattern

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 01:30, kimbllumi
Spring tides, when the high tides are at their highest and low tides at their lowest. what is it about these positions that causes these high and low tides?
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 15:00, NeverEndingCycle
The scales shown in the introduction measure mass, or the amount of matter in a particular object. the scientific law of conservation of mass states that matter cannot be created or destroyed during a chemical reaction, but it can change from one form to another. did the simulation support this scientific law? explain why or why not.
Answers: 1
image
Biology, 22.06.2019 15:40, milkshakegrande101
Read the article and use the information to answer the questions that follow discovering the structure of dna explain how the discoveries by rosalind franklin watson and crick build an accurate model of dna done
Answers: 2
Do you know the correct answer?
In a population of brown snakes, a snake is born with a white-spotted pattern. which factor will hav...

Questions in other subjects:

Konu
Social Studies, 25.05.2020 09:57