What are some of the factors that seem to prolong life in animals?

Select the correct answer. tay-sachs disease is caused by a mutation in the hexa gene located on chromosome 15. tay-sachs follows an autosomal recessive pattern of inheritance. with the of the diagram, identify which of the offspring will be an unaffected carrier. a diagram showing the genes of parents who are carriers of tay-sachs disease a. a, b, and c b. b and c c. a and d d. a e. d

The large increase in atmospheric carbon dioxide in the last 50 years most likely comes from a. an increase in cellular respiration b. increased decomposition by bacteria c. an increase in the burning of fossil fuels d. an increase in photosynthesis

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?