The messenger RNA codes for six different amino acids are shown in
the table.
In on type of m...
The messenger RNA codes for six different amino acids are shown in
the table.
In on type of mutated gene for hemoglobin, CTC in the DNA code was
replaced by CAC. What amino acid substitution has taken place in the
mutated hemoglobin?
Select one:
a. Valine has replaced glutamic acid.
b. Cysteine has replaced glutamic acid.
c. Serine has replaced leucine.
d. Arginine has replaced leucine.
Answers: 1
Biology, 22.06.2019 04:30, cgratz5106
Donde se encuentra el adn nuclear en un organismo eucariota?
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:30, crystalbyrd79p8imrx
Explain how light energy is turned into chemical energy? ! due tomorrow!
Answers: 1
English, 07.07.2019 14:00
Biology, 07.07.2019 14:00
Mathematics, 07.07.2019 14:00
Geography, 07.07.2019 14:00
Advanced Placement (AP), 07.07.2019 14:00
History, 07.07.2019 14:00
Geography, 07.07.2019 14:00
Biology, 07.07.2019 14:00