Biology, 15.04.2020 01:34, spoo262005
The compound phenylthiocarbamide (PTC) tastes very bitter to most persons. The inability to taste PTC is controlled by a single recessive allele. In the American white population, about 70% can taste PTC while 30% cannot (are non-tasters). Estimate the frequency of the Taster (T) and non-taster (t) alleles in this population, as well as the frequencies of the diploid genotypes.
Answers: 2
Biology, 22.06.2019 05:30, jeffhuffle17
What sre the effects of hemolytic disease of a newborn
Answers: 1
Biology, 22.06.2019 09:00, aranza78
Amarine ecologist has constructed the conceptual model shown in the diagram. what predictions can be made from using this model? where the tertiary consumers get their energy how often primary producers are able to reproduce when bacteria and fungi initiate the process of decomposition whether other secondary consumers are present
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:00, yolo123321
The climate on the leeward side of a mountain differs from that on the windward side mostly in
Answers: 2
The compound phenylthiocarbamide (PTC) tastes very bitter to most persons. The inability to taste PT...
Mathematics, 05.11.2019 23:31
Health, 05.11.2019 23:31
Business, 05.11.2019 23:31