Which of the following best describes passive transport?
O
A. Cellular transport in which the cell membrane pinches around a
substance in order to bring it into the cell
O
B. Cellular transport that requires cellular energy in the form of ATP
O
C. Cellular transport that does not require cellular energy
O
D. Cellular transport in which substances move from areas of low
concentration to areas of higher concentration

In a population that is in hardy-weinberg equilibrium, there are two possible alleles for a certain gene, a and a. if the frequency of allele a is 0.4, what fraction of the population is heterozygous? a. 0.40 b. 0.60 c. 0.16 d. 0.48

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Which cell organelle is the site for photosynthesis? a. chloroplast b. endoplasmic reticulum c. golgi apparatus d. lysosome