Biology, 17.10.2019 22:30, katiegresham2838
Shell orientation in snails is due to a maternal effect gene. a true breeding sinistral (recessive) is crossed to a true breeding dextral (dominant). the offspring from that cross are self-crossed. what will be the expected ratio of shell types?
a. all sinistral
b. all dextral
c. half sinistral, half dextral
d. 3/4 dextral, 1/4 sinistral
e. 3/4 sinistral, 1/4 dextral
Answers: 3
Biology, 22.06.2019 00:50, sedilei1515
What would be the result if crossing over did not happen during meiosis in humans? a. there would be less genetic variation in humans. b. parents would be more likely to look like their children. c. the human population could not reproduce. d. children would have more chromosomes.
Answers: 2
Biology, 22.06.2019 05:40, kaliyab191
Identify characteristics of energy from the sun. check all that apply. almost all of the energy on earth comes from the sun. energy from the sun is known as mechanical energy. the energy in fossil fuels originally came from the sun. plants convert the energy of sunlight into chemical energy.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Shell orientation in snails is due to a maternal effect gene. a true breeding sinistral (recessive)...
Chemistry, 14.05.2021 22:10
Mathematics, 14.05.2021 22:10
Mathematics, 14.05.2021 22:10
English, 14.05.2021 22:10
Mathematics, 14.05.2021 22:10