Spanish

Spanish, 24.08.2019 01:30, roseemariehunter12

Choose the correct verb conjugation.
ellas (mirar) a la maestra. (3 points)
miran
mira
miro
miras

answer

Answers: 2

Show answers

Other questions on the subject: Spanish

Spanish, 22.06.2019 00:10, khloenm309

Si no tuvieran que trabajar, raúl y dolores no todos los días. a las seis y cuarto

Answers: 3

Spanish, 22.06.2019 01:10, jpsaad00

Ifuera, compañero nuestro! alejandro, un estudiante de intercambio de españa, se muda (is moving) de su casa porque ya no se lleva bien (get along well) con sus compañeros. rellena los espacios en blanco con el adjetivo posesivo apropiado para saber como dividen las cosas entre ellos.

Answers: 1

Spanish, 22.06.2019 06:00, mykalwashington

¿en qué año se aceptó el tango en los salones de alta sociedad? a. 1896 c. en la década de 1910 b. 1898 d. en 1890

Answers: 1

Spanish, 23.06.2019 12:30, nidiavega2009

Ive been trying to figure this out for a week now , you basically explain how to get to each place (bottom right) starting from starting point , pls i need 1-10 by monday

Answers: 2

Do you know the correct answer?

Choose the correct verb conjugation.
ellas (mirar) a la maestra. (3 points)
miran
...

Questions in other subjects:

Konu

Business, 28.10.2019 21:31

Molly mocha employs one college student every summer in her coffee shop. the student works the five weekdays and is paid on the following monday. (for example, a student who works...

Konu

Chemistry, 28.10.2019 21:31

Which has the higher enthalpy under these conditions, 2 o3(g) or 3 o2(g)?...

Konu

Business, 28.10.2019 21:31

Jill lives in a large metropolitan area. she is thinking about starting a senior citizen van service, where she will pick up seniors from nursing homes and assisted living centers...

Konu

Mathematics, 28.10.2019 21:31

Give an example of a quadratic equation with 2 + 3i as one of its solutions...

Konu

Mathematics, 28.10.2019 21:31

Define: voluntary responsea) every possible sample of a given size has the same chance to be selected. b) using extraneous factors to create similar groups. c) the explanatory var...

Konu

Chemistry, 28.10.2019 21:31

Which of these equations represent reactions that could be used in constructing an electrochemical cell? check all that apply....

Konu

Chemistry, 28.10.2019 21:31

By looking at the uncertainty of the bacterium's position, did the student have a valid point? a. the student has a point. the uncertainty of the bacterium's position is mu...

Konu

Biology, 28.10.2019 21:31

Consider the following mrna strand: ccauggcaaaggagugacuaa a. what dna sequence would encode for this mrna? provide the sequence in form (single-or doublestranded) in which...

Konu

Biology, 28.10.2019 21:31

What is the main advantage of a sole proprietorship?...

Konu

Physics, 28.10.2019 21:31

Development of life goals, access to community resources, long-term counseling, and accountability are all examples of case management....

Other tasks in the category: Spanish More task