This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place. ATTTGCATACTACCGGGC The red letters are the noncoding region, and the black letters are the protein coding region. ATTAGCATACTACGGGC ATTTGCATACTGACCGGGC ATTTGCAATACTACCGGGC ATTTGCAACTACCGGGC ATGAATGCATACTACCGGGC

The graph shows a student’s data from an investigation about plant growth in five plants of the same type.

Which quotation reflects the perspective of most of georgia legislatures in 1956 regarding the georgia state flag? "georgia's flag should be updated to have a more modern look and design." "georgia's flag should be a symbol of integration and equal rights." "georgia's flag does not need to be changed; it represents peace and prosperity." "georgia's flag should be a symbol of our resistance to federal integration laws."

Give an example of a situation in which an individual's pursuit of economic self-interest may not benefit but instead harm the rest of society