Mathematics

Mathematics, 30.04.2021 17:20, daniellaZemira

What is 468,839 rounded to the nearest hundred thousand?

answer

Answers: 1

Show answers

Other questions on the subject: Mathematics

Mathematics, 21.06.2019 15:00, cal1805p8uo38

Aregular hexagon rotates counterclockwise about its center. it turns through angles greater than 0° and less than or equal to 360°. at how many different angles will the hexagon map onto itself?

Answers: 2

Mathematics, 21.06.2019 18:10, russbeast6584

What is the value of x in the following equation. -x ^3/2 = -27

Answers: 1

Mathematics, 21.06.2019 18:30, george6871

Abus travels 36 miles in 45 minutes. enter the number of miles the bus travels in 60 minutes at this rate.

Answers: 2

Mathematics, 21.06.2019 20:00, danielburke24

How long does it take natsumi to clean up after she is done? table: .area time30. 245. 2.7560. 3.5

Answers: 2

Do you know the correct answer?

What is 468,839 rounded to the nearest hundred thousand?...

Questions in other subjects:

Konu

Chemistry, 14.04.2021 23:40

If an astronaut weighs 79 kilograms (175 pounds) and his space suit weighs 50 kilograms (110 pounds), how much would the astronaut and his suit weigh on the Moon?...

Konu

Biology, 14.04.2021 23:40

What is the complementary DNA of TACCGGATGCCAGATCAAATC?...

Konu

Mathematics, 14.04.2021 23:40

A cone has a radius of 3 feet and a height of 2 feet. How many cones of liquid would it take to fill a cylinder with a diameter of 6 feet and a height of 2 feet? Complete the expla...

Konu

Mathematics, 14.04.2021 23:40

If the magnitude of vector U is ||u|| ≈ 7.81 and its angle of direction is 129.81°, which graph represents vector -u?

Konu

Mathematics, 14.04.2021 23:40

Water is being drained from a swimming pool containing 12,000 gallons of water. After one hour passes, 60% of the water remains. At the start of the fifth hour, how many gal...

Konu

Mathematics, 14.04.2021 23:40

¿Cuántos factores iguales tiene la potencia 0 elevado a 2 y 0 elevado a 5? ¿ Y cómo podemos generalizar la situación?...

Konu

Mathematics, 14.04.2021 23:40

A round clock has a radius of 5 cm. What is the approximate area of the clock? Use 3.14 for pi. 0 31.4 square centimeters 314 square centimeters 78.5 square cent...

Konu

Mathematics, 14.04.2021 23:40

George goes to the pool store with his father to get chlorine. Each jug weighs 7.8 pounds. If they get 10 jugs, how much does all the chlorine weigh?...

Konu

Health, 14.04.2021 23:40

Steal the Flag Rules: Question 1 You can get out on your own side if your flag gets pulled while holding the ball. True or false...

Konu

Social Studies, 14.04.2021 23:40

Follow Jaysuels on twitch...

Other tasks in the category: Mathematics More task