Mathematics, 02.07.2019 05:10, tyboutlife

Abungee jumper falls from a bridge 300 feet above ground. her height above ground after t seconds is given by the equation h= -16t square+300
, where h is the height of the jumper in feet and t is the time in seconds after she jumps. approximately how long will it take for the bungee jumper to reach 100 feet above the ground on her initial jump?

Answers: 2

Show answers

Other questions on the subject: Mathematics

Mathematics, 21.06.2019 14:00, kenziepickup

Roger and natalie travel in similar cars. roger's car drives the two miles to school in 7.5 minutes. natalie drives the same distance in the opposite direction but in only 6.5 minutes. what is true of their velocities?

Answers: 1

continue

Mathematics, 22.06.2019 00:30, dmart201

Will mark ! (10 points also! ) if x varies inversely with y and x =6 when equals y= 10, find y when x=8 a. y=4.8 b. y=7.5 c. y=40/3 d. y=4/15

Answers: 1

continue

Mathematics, 22.06.2019 03:00, sairaanwar67

For the following equations, find the ratio of a to b. be sure to show all of your work. a. 3a = 6b b. 15a = 5b

Answers: 2

continue

Mathematics, 22.06.2019 03:00, jonquil201

Benjamin believes that ¼ % is equivalent to 25%. is he correct? why or why not?

Answers: 1

continue

Do you know the correct answer?

Abungee jumper falls from a bridge 300 feet above ground. her height above ground after t seconds is...

Questions in other subjects:

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b. Taking advantage of changes i...

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this seq...

Mathematics, 15.04.2020 03:54

A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the construction process. The pond's...

Mathematics, 15.04.2020 03:54

1. Write the polynomial in standard form. Identify the degree and leading coefficient of the polynomial. $-3p^3+5p^6-4$ The polynomial in standard form is:. Th...

Mathematics, 15.04.2020 03:54

Mitch wants to buy a camera. The sale price is $291. What was the original price? 25% off original price....

Computers and Technology, 15.04.2020 03:54

We have the following functional dependencies: course_no, student_id -> grade course_no -> course_name We have the following relation schema: STU_...

Physics, 15.04.2020 03:54

A man unloads a 4.0-kg box from a moving van by giving it an initial speed of 1.1 m/s down a ramp that makes an angle of 18° with the horizontal. It slides with negligible friction...

Business, 15.04.2020 03:54

One reason new products fail is that although most major corporations use a formal decision-making process, sometimes they fail to critically evaluate the progress along the way. T...

Health, 15.04.2020 03:54

Max is a seven-month-old baby who was abandoned at an orphanage. He does not get enough nutrition and has not put on any weight in the last few months. A medical worker examines Ma...

Business, 15.04.2020 03:54

A large retail organization previously divided work among its four employee-benefitsstaff into distinct specializations. One person answered all questions about superannuation (pen...

Other tasks in the category: Mathematics More task