History

History, 30.11.2020 06:40, pgfrkypory2107

After the Umayyads conquered Northern Africa, the Muslims sailed north from Tangier to conquer which European country? A
Spain
B
France
С
Italy
D
Egypt

answer

Answers: 2

Show answers

Other questions on the subject: History

History, 21.06.2019 19:00, balochmisbah6626

This was an order issued during the civil war by president lincoln ending slavery in the confederate states

Answers: 2

History, 22.06.2019 05:30, kingethan08

Write an account of the boston massacre from the point of view of a british soldier involved in the event

Answers: 1

History, 22.06.2019 09:30, danksans7011

The clergy comprised the wealthy first estate with members of noble descent in particular having a great deal of power. what was the source of the clergy’s wealth

Answers: 1

History, 22.06.2019 10:30, tammydbrooks43

Which revision stands out as most effective for a multimedia presentation slide? sources were left out. the language is simplified. a lot of the information is left out. sentences were used instead of phrases.

Answers: 2

Do you know the correct answer?

After the Umayyads conquered Northern Africa, the Muslims sailed north from Tangier to conquer which...

Questions in other subjects:

Konu

SAT, 29.12.2021 04:10

Kent multiplies both sides of the equation below by an expression. K + startfraction 12 over k endfraction = 8 then he moves all the terms to one side of the equal sign in the resu...

Konu

SAT, 29.12.2021 04:10

Compare the character of faustus at the beginning of the play with his character at the end. How have his character traits and basic ambitions shifted over the course of the play?...

Konu

Biology, 29.12.2021 04:10

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA...

Konu

SAT, 29.12.2021 04:10

A stone fell from the top of a cliff into the ocean. In the air, it had an average speed of 161616 \text{m/s}m/sstart text, m, slash, s, end text. In the water, it had an average s...

Konu

Mathematics, 29.12.2021 04:10

What is 18 1/5 -7 3/5 as a mixed number in simplest form...

Konu

SAT, 29.12.2021 04:10

What are the typical sources of data which is used for data analytics....

Konu

Chemistry, 29.12.2021 04:10

Which of these describes a human activity that uses up a non-renewable resource? building new roads that cause topsoil to erode chopping down trees from the forest fo...

Konu

SAT, 29.12.2021 04:10

Which general trends in atomic radius and electronegativity are observed....

Konu

Health, 29.12.2021 04:10

a couple undergoes a workup for infertility, which shows that the man has a low sperm count. the couple asks why this is a problem because it only takes one sperm to fertilize an e...

Konu

SAT, 29.12.2021 04:10

Which of these factors would be considered when making a location decision at the region or community level?....

Other tasks in the category: History More task