Write a python program that converts an input file in fasta format, called
"fasta. txt", to an...
Computers and Technology, 17.12.2019 05:31, duhitsmiracle59
Write a python program that converts an input file in fasta format, called
"fasta. txt", to an output file in phylip format called "phylip. txt".
for example if the input file contains:
> human
accgttatac
cgatctcgca
> chimp
acggttatac
cgtacgatcg
> monkey
acctctatac
cgatcgatcc
> gorilla
atctatatac
cgatcgatcg
then the output file should be
human accgttataccgatctcgca
chimp acggttataccgtacgatcg
monkey acctctataccgatcgatcc
gorilla atctatataccgatcgatcg
fasta format has a description (indicated with a '> ') followed by 1 or
more lines of a dna sequence. phylip format has a description followed
by a single line of a dna sequence and each sequence is the same length.
for this homework, the input file will have an arbitrary number of
sequences of arbitrary, but identical, length
Answers: 2
Computers and Technology, 22.06.2019 01:30, yudayang2012pa9u8p
Consider the following statements: #include #include class temporary { private: string description; double first; double second; public: temporary(string = "", double = 0.0, double = 0.0); void set(string, double, double); double manipulate(); void get(string& , double& , double& ); void setdescription(string); void setfirst(double); void setsecond(double); }; write the definition of the member function set() so that the instance variables are set according to the parameters. write the definition of the constructor so that it initializes the instance variables using the function set() write the definition of the member function manipulate() that returns a decimal number (double) as follows: if the value of description is "rectangle", it returns first * second if the value of description is "circle" it returns the area of a circle with radius first if the value of description is "cylinder" it returns the volume of a cylinder with radius first and height second. hint: the volume of a cylinder is simply the area of the circle at the base times the height. if the value of description is "sphere" it returns the volume of the sphere with radius first. otherwise it returns -1.0;
Answers: 1
Computers and Technology, 22.06.2019 15:30, 1232444553
Which of the following examples has four beats in each measure?
Answers: 2
Computers and Technology, 22.06.2019 22:20, kaiyerecampbell95
Pp 4.1 design and implement a class called sphere that contains instance data that represents the sphere’s diameter. define the sphere constructor to accept and initialize the diameter and include getter and setter methods for the diameter. include methods that calculate and return the volume and surface area of the sphere (see pp 3.5 for the formulas). include a tostring method that returns a one-line description of the sphere. create a driver class called multisphere, whose main method instantiates and updates several sphere objects.
Answers: 1
Mathematics, 04.11.2019 05:31
Advanced Placement (AP), 04.11.2019 05:31
Mathematics, 04.11.2019 05:31
Biology, 04.11.2019 05:31
French, 04.11.2019 05:31