Chemistry

Chemistry, 02.10.2019 11:00, autumnskye1

Acompany is interested in buying a new machine to replace their outdated equipment. however, before committing to the purchase, the company asks the manufacturer to provide data on a certain machine's efficiency. the data suggests that with a supplied energy at a rate of 1,600 w, the machine will do useful work at a rate of 1,540 w. what's the efficiency of this particular machine? a. 103.90% b. 96.25% c. 77.00% d. 84.21%

answer

Answers: 2

Show answers

Similar questions

Предмет

Business, 22.06.2019 05:50, marjae188jackson

Acompany that makes shopping carts for supermarkets and other stores recently purchased some new equipment that reduces the labor content of the jobs needed to produce the shopping carts. prior to buying the new equipment, the company used 6 workers, who produced an average of 79 carts per hour. workers receive $16 per hour, and machine coast was $49 per hour. with the new equipment, it was possible to transfer one of the workers to another department, and equipment cost increased by $11 per hour while output increased by four carts per hour. a) compute the multifactor productivity (mfp) (labor plus equipment) under the prior to buying the new equipment. the mfp (carts/$) = (round to 4 decimal places). b) compute the productivity changes between the prior to and after buying the new equipment. the productivity growth = % (round to 2 decimal places)

Answers: 3

Предмет

Business, 17.08.2019 23:10, charnaetoney13

Granfield company has a piece of manufacturing equipment with a book value of $36,500 and a remaining useful life of four years. at the end of the four years the equipment will have a zero salvage value. the market value of the equipment is currently $21,300. granfield can purchase a new machine for $113,000 and receive $21,300 in return for trading in its old machine. the new machine will reduce variable manufacturing costs by $18,300 per year over the four-year life of the new machine. the total increase or decrease in net income by replacing the current machine with the new machine (ignoring the time value of money) is:

Answers: 3

Предмет

Business, 04.10.2019 20:20, tanoah7623

On july 1, 2016, alpha company negotiated the purchase of a new piece of equipment with the seller zulu company. the equipment was list for $200,000. smooth talking alpha was able to negotiate the purchase price and acquired the equipment at $175,000. alpha company completed the purchase transaction on july 1. additionally, alpha was entitled to a 1% discount if it paid for the equipment within 10 days. after completing the purchase, bravo company, third party, offered alpha, $185,000 for this equipment. what amount should alpha company record the equipment purchase at if payment is made by july 11?

Answers: 1

Do you know the correct answer?

Acompany is interested in buying a new machine to replace their outdated equipment. however, before...

Questions in other subjects:

Konu

Physics, 22.02.2021 19:00

Put the following objects in order of increasing momentum: a parked car, a train moving at 50 km/h, a train moving at 80 km/h, a car moving at 50 km/h....

Konu

Mathematics, 22.02.2021 19:00

I will give first person brainlist for first answer i need help fast Mr. McCoy entered his classroom at 8:00 am and found the temperature to be 86 degrees. He immediately turns on...

Konu

Geography, 22.02.2021 19:00

Em que consistia uma carta de foral...

Konu

Mathematics, 22.02.2021 19:00

What are the next three terms in the sequence 4,8,12,16?...

Konu

Spanish, 22.02.2021 19:00

Please help , I need today ...

Konu

English, 22.02.2021 19:00

The girls are playing in the garden Look very _happy Complete the following sentences with the correct pronoun :...

Konu

Mathematics, 22.02.2021 19:00

An experiment consists of tossing a die and then flipping a coin once if the number on the die is even. If the number on the die is odd, the coin is flipped twice. Using the notati...

Konu

Biology, 22.02.2021 19:00

Go to the science techbook on discovery ed. Go to concept 5.4 and use the genetic code chart to construct the polypeptide coded for below: 5' CCAAUUCAUGUCAAAGAUUAA 3'...

Konu

Mathematics, 22.02.2021 19:00

A statement in which you to negate both the hypothesis and conclusion....

Konu

Mathematics, 22.02.2021 19:00

Can I have some help please. ...

Other tasks in the category: Chemistry More task