Biology, 21.07.2019 08:30, makylahoyle
Some plants on the coast of the ocean have the unique ability to take in salt water. marsh plants are able to take in the salt water and separate the salt so that they can use the water for photosynthesis. they then excrete the salt onto the surface of their leaves. this trait allows them to survive in a place where many other plants cannot- this is an example of: speciation mutation variation adaptation
Answers: 1
Biology, 21.06.2019 23:10, gobbler80
Getting out of bed is the first goal i tackle each day. 2several small goals are achieved by me as the day progresses. 3when i am riding the bus home or walking the dog, i think about the bigger goals i have for my life. which statement correctly describes the verb tense, aspect, and voice in this paragraph? a. sentences 1 and 2 contain present progressive verbs. sentence 3 contains both present progressive and simple present verbs. sentence 2 uses passive voice. b. sentences 1 and 2 contain simple present verbs. sentence 3 contains present progressive verbs. all three sentences use active voice. c. sentences 1 and 2 contain present progressive verbs. sentence 3 contains simple present verbs. all three sentences use active voice. d. sentences 1 and 2 contain simple present verbs. sentence 3 contains both present progressive and simple present verbs. sentence 2 uses passive voice.
Answers: 3
Biology, 22.06.2019 10:30, netflixacc0107
Which of the following words best matches this definition: the process in which the best adapted organisms survive and pass on their traits, while those that are not well adapted do not survive to pass on their traits. question 3 options: acquired selection natural selection artificial selection organic selection
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:00, sabrinachambers444
Which was not a reason why canals were built in florida
Answers: 1
Some plants on the coast of the ocean have the unique ability to take in salt water. marsh plants ar...
Mathematics, 03.02.2020 03:49
Biology, 03.02.2020 03:49
Mathematics, 03.02.2020 03:49
Biology, 03.02.2020 03:49