![Biology](/tpl/images/cats/biologiya.png)
Biology, 25.07.2019 02:00, etxchrissy
Dna replication is called semiconservative because of the original double-helix appears in one daughter strand formed in replication.
![answer](/tpl/images/cats/otvet.png)
Answers: 1
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 21:30, airsealands
Which of these best describes wde by replicating the chromosomes c) the cytoplasm is divided between the two new daughter cells d) the nucleus opens to allow the chromosomes to enter the cytoplasm
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:30, laurabwhiddon
Approximately percent of the energy created by cell metabolism is used by the body to carry on its normal functions, such as respiration, digestion, reproduction, muscular movement, circulation, and cellular regrowth.
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:50, prxncekevin
What is it called when part of a cell membrane closes around a molecule to allow the molecule to enter the cell? a. passive transport b. diffusion c. endocytosis d. exocytosisc. endocytosis
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Dna replication is called semiconservative because of the original double-helix appears in one daug...
Questions in other subjects:
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/istoriya.png)
History, 24.11.2019 22:31
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/himiya.png)
Chemistry, 24.11.2019 22:31
![Konu](/tpl/images/cats/fizika.png)
![Konu](/tpl/images/cats/mkx.png)
Arts, 24.11.2019 22:31
![Konu](/tpl/images/cats/istoriya.png)
History, 24.11.2019 22:31
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 24.11.2019 22:31
![Konu](/tpl/images/cats/istoriya.png)
History, 24.11.2019 22:31