![Biology](/tpl/images/cats/biologiya.png)
How does radiometric dating scientists pinpoint the age of a fossil? in radiometric dating, scientists place samples of a fossil in certain liquids until the samples dissolve. the rate at which they dissolve indicates the age of the fossil. in radiometric dating, scientists mix the carbon in a fossil with carbon from similar fossils whose age they know. by comparing the carbon, they can tell the exact age of the fossil. radiometric dating allows scientists to find fossils in only the lowest and oldest layers of sediment. radiometric dating shows the rate of decay of radioactive material present in any object. scientists can use that data to find the absolute age of the fossil.
![answer](/tpl/images/cats/otvet.png)
Answers: 1
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:00, jorgepas66
The tubes transporting minerals and water upward are called ?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30, lilyrockstarmag
Describe your dna model. which part do the straws represent? the pushpins? the paper clips and the black dots you made with the marker?
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:00, jessicap7pg75
Which skeletal system is represented by the shaded portion of the skeleton? spongy skeleton compact skeleton axial skeleton appendicular skeleton
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
How does radiometric dating scientists pinpoint the age of a fossil? in radiometric dating, scient...
Questions in other subjects:
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/es.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 04.02.2020 23:52
![Konu](/tpl/images/cats/es.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 04.02.2020 23:52
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 04.02.2020 23:52
![Konu](/tpl/images/cats/biologiya.png)
Biology, 04.02.2020 23:52