Biology
Biology, 02.08.2019 03:00, keidora

Which organelles serve as the energy centers for most protists?

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 04:00, Mw3spartan17
1) strawberry plants typically reproduce by making runners, which are miniature versions of themselves, that grow off of the roots and stems of the parent. this type of vegetative reproduction is known as a) pollination. b) fragmentation. c) binary fission. d) vegetative propogation.
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 16:00, postorivofarms
Which of these outcomes is a negative impact of postindustrial societies on the environment? a. nomadic ways b. overpopulation c. overgrazing d. resource renewal
Answers: 3
image
Biology, 22.06.2019 23:10, levin69
Tag ctt ggc at what kind of mutation is this?
Answers: 3
Do you know the correct answer?
Which organelles serve as the energy centers for most protists?...

Questions in other subjects:

Konu
Mathematics, 08.04.2020 03:09