The original population of brown spotted deer declined drastically after their forest habitat was flooded. after frantic efforts over three decades by the forest authorities to revive the dwindling population, it did bounce back. now the deer population is as huge as it was three decades ago, but it shows a decreased amount of genetic variations. which factor could be responsible for this microevolution? a) bottleneck effect b) natural selection c) founder effect d) gene flow
Answers: 1
Biology, 22.06.2019 03:00, brianfranklin17
Which of the following is the best definition for the process of photosynthesis? a.) plants digest sugars to make energy. b.) plants use oxygen and glucose to make carbon dioxide. c.) plants use sunlight and carbon dioxide to make sugars. d.) plants use sunlight to make chlorophyll and chloroplasts.
Answers: 2
Biology, 22.06.2019 07:00, dlatricewilcoxp0tsdw
Which best describes a gene? a. a sister chromatid b. a chromosome c. a tetrad d. a piece of a chromosome
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:00, chloejaylevesque
Atest cross can be used to -predict the phenotypes of a monohybrid cross -predict an unknown genotype of a purebred dominant plant -cross-breed dominant and recessive plants -give probabilities that a trait will appear
Answers: 1
The original population of brown spotted deer declined drastically after their forest habitat was fl...
Mathematics, 13.08.2020 02:01
Computers and Technology, 13.08.2020 02:01
History, 13.08.2020 02:01
Mathematics, 13.08.2020 02:01
English, 13.08.2020 02:01
Mathematics, 13.08.2020 02:01