Biology
Biology, 31.08.2019 14:20, edna27

What element do all organic compounds contain

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 20:00, bettinger6525
Part a - prefixes, roots, and suffixes match these prefixes, suffixes and roots to their meanings. phospho- angio- -uria -tropic -phag- a. the word root means blood or lymph vessels. b. the word root means urine. c. the word root means feeding or eating. d. the word root means phosphate or phosphorus. e. the word root means attracted specifically to the specified organ or tissue. part b – match these vocabulary terms to their meanings. gonadotropic polyuria angiotensin ii polyphagia phosphodiesterase upon the release of renin, is produced and stimulates vasoconstriction and the release of aldosterone. fsh and lh are examples of hormones, which target the ovaries or testes. an enzyme that degrades second messengers like camp or cgmp is . overproduction of urine, or , is a sign of diabetes mellitus. overeating, or , is a sign associated with diabetes mellitus.
Answers: 2
image
Biology, 22.06.2019 01:00, lindasuebairdoyjpf7
Where do the respiratory and circulatory systems meet? a. in the heart b. in the muscles c. in the lungs d. in the brain
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 14:30, reinajoy
Which of these is not an example of molecular homology? 1. use of dna and rna as genetic material 2.use of glycolysis as the first step in cellular respiration in both plants and animals 3. the lack of an igf-1 gene in prokaryotes 4. the use of aldolase b to break down fructose in bacteria, plants and animals
Answers: 3
Do you know the correct answer?
What element do all organic compounds contain...

Questions in other subjects:

Konu
Mathematics, 15.12.2020 22:40