Biology
Biology, 08.07.2019 05:50, SamaraP

The force driving simple diffusion is while the energy source for active transport is

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 02:00, nikki8240
The phylogenetic tree illustrates the relationship between humans and our closest living relatives. the tree was based on biochemical comparisons, including dna and amino acid sequences. according to the biomolecular data, we could infer that
Answers: 1
image
Biology, 22.06.2019 03:30, fnaflover8505
Awire-hair terrier and a smooth-hair terrier are mated. the offspring produced are 6 wire-hair puppies and 2 smooth-hair puppies. a. what pattern of inheritance best describes this situation? b. what is the genotype(s) of the wire-haired puppies? of the smooth-haired puppies? c. what would be the expected genotype and phenotype ratios of a mating between 2 wire-haired terriers that are heterozygous?
Answers: 3
image
Biology, 22.06.2019 08:50, karlagomezgarcia96
Iwill make you brainliest pleeze answer this fast i have to turn it in really soon brainliest promise easy question 6th grade ! a weather map shows a high pressure system with circles around it. what does this mean? a) an occluded front b) areas of equal altitude c) areas of equal pressure d) a stationary front
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
The force driving simple diffusion is while the energy source for active transport is...

Questions in other subjects: