Biology
Biology, 30.06.2019 23:00, yhhh

What are three structures that are found in plant cells but not in animal cells?

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 18:30, YwnDerek
How is the male reproductive system different from other body systems? it isn’t necessary to vital signs. it monitors other body systems, and adjusts if necessary. it transports items from one system to another. it is the only system that produces hormones in the male.
Answers: 3
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 12:00, AnimePo2020
What type of graph presents information about how often certain or traits occur?
Answers: 1
image
Biology, 22.06.2019 15:50, Nigward666
We all have different forms of genes from our parent(s).what are these different forms called? a. alleles b. characters c. dna d. resources
Answers: 2
Do you know the correct answer?
What are three structures that are found in plant cells but not in animal cells?...

Questions in other subjects: