Answers: 1
Biology, 22.06.2019 05:30, 0prayforthelost0
Which of these is true for bacteria because they are prokaryotic cells? a. they can engulf body cells in order to make memory cells. b. they must invade viruses in order to reproduce. c. they are much larger than eukaryotic body cells. d. they can reproduce on their own outside of other cells.
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 21:30, lovelyheart5337
Scientists studied reproduction in the new zealand mud snail to answer the question, “are there benefits to reproducing sexually or asexually? ” which of these hypotheses would least likely aid the scientists as they worked to answer the question? sexual reproduction is advantageous over asexual reproduction because it reduces the rate of mutation accumulation. asexual reproduction is advantageous over sexual reproduction because it allows the snails to produce more offspring. sexual reproduction is advantageous over asexual reproduction because it allows for snails to have increased genetic variation. asexual reproduction is advantageous over sexual reproduction because it decreases the snails’ need for social
Answers: 2
Biology, 22.06.2019 22:00, xaniawashington
Which of the following statements best describes homeostasis
Answers: 1
A major function of prokaryotic gas vesicles is to....
Business, 31.10.2019 20:31
Mathematics, 31.10.2019 20:31
Mathematics, 31.10.2019 20:31
Mathematics, 31.10.2019 20:31
Mathematics, 31.10.2019 20:31
History, 31.10.2019 20:31