Biology, 10.02.2022 14:30, Shadow0202
Immune cells that originate in the bone marrow and migrate to the epidermal layers of the stratum spinosum and stratum granulosum are called:
Answers: 2
Biology, 22.06.2019 01:00, dahn
What can be said about farmers in highly developed countries? a) they have little or no negative impact on the environment. b) they practice subsistence agriculture. c) they are able to incorporate polyculture into their farming practices. d) they utilize organic farming techniques on a regular basis. e) they rely on large amounts of energy from fossil fuels.
Answers: 3
Biology, 22.06.2019 02:30, soliseric879
Apaleontologist finds a plant fossil that shows that the plant had seeds. what can the paleontologist conclude?
Answers: 1
Biology, 22.06.2019 08:10, Haneendye123
In sweet pea, gene c is responsible for color production and gene p is responsible for the purple color pigment. both of them are located on two different loci on different chromosomes. the flowers will be purple only when the plant has the genotypes as c_p_. no color will be produced with genotypes: ccpp, ccpp, ccpp, ccpp. thus, gene c controls the expression of gene p. what pattern of inheritance is exhibited here? a. pleiotropy b. epistasis c. multiple alleles
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Immune cells that originate in the bone marrow and migrate to the epidermal layers of the stratum sp...
Mathematics, 23.03.2021 03:30
Mathematics, 23.03.2021 03:30
Mathematics, 23.03.2021 03:40