Biology
Biology, 10.01.2022 09:20, Rubendelarosa1529

As a person pushes a box across a floor , the energy from the persons moving arm is transferred to the box , and the box and the floor become warm .During this process , what happens to energy ?

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 22.06.2019 10:00, abbypark0804
Which step is not included in the step approach to calculating the greatest common divisor?
Answers: 3
image
Biology, 22.06.2019 10:50, keasiabradley
Overtime the pond slowly becomes more acidic due to the release of chemicals from a nearby factory. which of the organisms would most likely survive the change to their environment?
Answers: 1
image
Biology, 22.06.2019 11:00, eweqwee3147
Fill in the blank 1. digestion occurs in the small intestine through the action of enzymes. 2. urea, excess water, and other waste materials are eliminated in a water fluid called 3. can cause infections by injecting dna or rna into hosts. 4. the human immune system produces in response to a vaccine, which later can bind to and destroy a pathogen if it invades. 5. are structures that link bone to bone at a joint 6. in the heart, blood flows from the right atrium to the right ventricle, where it is pumped to the the words i can use are: lymphocytes gliding pivot gas urine absorption dermis fulcrum lungs chemical viruses capillary vertebrae esophagus tendons antibodies synapses ligaments kidneys pathogens
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
As a person pushes a box across a floor , the energy from the persons moving arm is transferred to t...

Questions in other subjects:

Konu
Mathematics, 02.07.2019 19:40
Konu
English, 02.07.2019 19:40
Konu
Mathematics, 02.07.2019 19:40