Biology, 08.01.2022 16:10, gigioschoch

Genes include information used to make something in cells. What is supposed to happen with the information on the gene for dystrophin and what happens when a person has a mutation of the gene?

Answers: 3

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 07:30, china2221

The ancestors of plants that lived in water had plenty of water for the young. angiosperms are a group of land plants that evolved a reproductive trait for living on land. this trait protect young plants by allowing them to grow only when water is present and the conditions for healthy development are right. what trait most likely young angiosperms in this way?

Answers: 1

continue

Biology, 22.06.2019 11:00, yasarhan2

Many organizations release indexes used to measure the development of the world's countries. as we learned in this lesson, these indexes measure many factors, from life expectancy to happiness. in your opinion, what are the three most important factors we can use to determine how developed a country might be? explain your answers in a few sentences.

Answers: 1

continue

Biology, 22.06.2019 11:30, gymnastcaitlyn1

There are multiple lines of evidence that provide support for common ancestry and evolution. write 3-4 paragraphs describing at least three of them in detail. provide at least one example for each line of evidence.

Answers: 1

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

Do you know the correct answer?

Genes include information used to make something in cells. What is supposed to happen with the infor...