If a single cycle of PCR takes 5 minutes, it should it take minutes to amplify one double-stranded molecule into 64.

Multicellular organisms use cell division, mitosis, for growth and the maintenance and repair of cells and tissues. single-celled organisms may use cell division as their method of reproduction. regardless of the reason for mitosis, the process ensures genetic continuity. what is the step in the cell cycle that ensure genetic continuity?

Idon’t know the answer and i’ve been stuck on it for a while now skskskskks

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?