![Biology](/tpl/images/cats/biologiya.png)
Biology, 08.12.2021 05:50, winchester729
The oldest rocks on earth date from about 4.2 billion years ago. What does this suggest about the interval between 4.6 billion years ago, when the earth started to form, and 4.2 billion years ago ?
![answer](/tpl/images/cats/otvet.png)
Answers: 1
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:20, bennettaly2452
The negative change found inside the plasma membrane is created by potassium ions sodium ions hydrogen ions chlorine ions
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30, goopatogen5889
Which statement names a physical property of wood? wood does not rustwood can burnwood can rotwood is softer than coal
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:50, afropenguin2853
Which of the following describes how binary fission and mitosis are similar? a)they are both used for growth or repair b)they both break down membrane-bound nuclei c)both invoke the replication of a single stand of dna d)both replicate genetic material
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
The oldest rocks on earth date from about 4.2 billion years ago. What does this suggest about the in...
Questions in other subjects:
![Konu](/tpl/images/cats/fizika.png)
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 22.10.2019 23:10
![Konu](/tpl/images/cats/biologiya.png)
Biology, 22.10.2019 23:10
![Konu](/tpl/images/cats/health.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 22.10.2019 23:10
![Konu](/tpl/images/cats/health.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/istoriya.png)