Answers: 1
Biology, 21.06.2019 23:00, jacquicmoreland2106
Neelaredoxin is a 15-kda protein that is a gene product common in anaerobic prokaryotes. it has superoxide-scavenging activity, and it is constitutively expressed. in addition, its expression is not further induced during its exposure to o2 or h2o2 (silva, g., et al. 2001. j. bacteriol. 183: 4413–4420). which of the following statements best describes neelaredoxin synthesis? a-neelaredoxin is produced at all times; levels are constant even when exposed to o2 or h2o2.b-neelaredoxin is produced at all times; exposure to o2 or h2o2 increases expression. c-neelaredoxin is produced at all times; exposure to o2 or h2o2 decreases or prevents expression. d-neelaredoxin is only produced when there is exposure to o2 or h2o2.
Answers: 3
Biology, 22.06.2019 06:20, justinamber89
Cells are adapted to preform specific functions. which of the following terms refers to this capability?
Answers: 2
Biology, 22.06.2019 08:20, AgarioEdit
The table lists the observations students made about four specimens under a microscope. based on these observations, what specimens did the students examine? animal plant virus prokaryote cell membrane present ribosomes present lysosomes present nuclear membrane present cell wall present ribosomes present nuclear membrane absent cell wall present ribosomes present nucleus present large vacuole present reproduces inside of a cell nucleus absent rna present 2019 edmentum all rights reserved intl
Answers: 2
Biology, 22.06.2019 16:30, leverso
Which of the following may one conclude from a map that shows the average ph value of rainfall in the u. s.? acid rain is a more serious problem on the east coast. acid rain falls equivalently across the continental u. s. there are more factories on the west coast. the midwest has fewer forests than the rest of the u. s.
Answers: 1
Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACGCGCTTACGTCTGATCGCT...
Mathematics, 25.03.2020 05:18
Chemistry, 25.03.2020 05:19
Mathematics, 25.03.2020 05:19