Biology, 06.12.2021 08:40, sadsociety41

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5'

Type of mutation ( 3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

2. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' TACGCGCTTACGTCTGATCGCT 5'

Type of mutation ( 3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

3. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' 5'

Type of mutation (3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' 5'

Type of mutation ( 3pts) :

Amino acid ( 3pts):

Type of mutation ( 3pts):

5. What is the difference between a point mutation and a frameshift mutation? 4pts

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 19:00, pattyv9845

Iron reacts with oxygen to produce iron oxide (rust). this reaction is represented in an equation as 4fe + xo2 → 2fe2o3. identify the value of x that will balance the equation.

Answers: 3

continue

Biology, 22.06.2019 00:30, stgitskaysie9028

Each pair of clay balls represents two planetesimals. if each planetesimal is composed of the same material and is separated he the same distance, which pair experiences the frayed gravitational attraction?

Answers: 1

continue

Biology, 22.06.2019 01:00, fryday2516

Which represents a negative impact of technology

Answers: 1

continue

Biology, 22.06.2019 18:00, deena7

How many bones are there in the human body?

Answers: 2

continue

Do you know the correct answer?

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGA...