Need help look at pdf/link part 5. a b and c 1. Use this sequence of DNA to answer the following former test questions:
5’-- TTAATGGGACAGCTTGTGTAGAGG --3’
a. What is the complementary strand of DNA?
b. Using the complementary strand of DNA (your answer from part a) as the template
strand, what is the transcribed mRNA sequence?
c. What is the amino acid sequence translated from the strand of mRNA synthesized in
part b (use the genetic code below)?
Remember:
i. Start codon!
ii. Stop codon!

Chart in pdf

answer; i believe that the correct answer is ; males are hemizygous for the x chromosome;

a researcher conducts an experiment on the secretion of a particular hormone in mice. scientists inject mice with a substance that stimulates the production of the hormone. the scientists then test the levels of hormones produced by the mice. the tool used to measure the hormones consistently detects the levels at 10 points lower than the actual hormone levels in the mice. this tool makes measurements, but the measurements aren't .

explanation:

no u

ionic bonds are two oppositely charged ions that attract. a sodium ion has a 1 positive charge; a chloride ion has a 1 negative charge. sodium and chloride have oppostive charged ions that attract which forms an ionic bond. a chemical bond formed when two atoms share electrons is called