Biology
Biology, 25.11.2021 06:50, kbmom1202

Which of the following is the correct complementary sequence to the one listed below:
GCAAGTCAGGTCT
O CGTTCACTCCAGA
OGCTTCAGTCCAGA
OCGTACAGTCCAGA
OCGTTCAGTCCAGA

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 01:40, warnene17
Elephants in the savanna regions of africa dig holes in dried up river beds to reach water lying just below the surface. these holes provide drinking water for other animals as well. so, without the elephants, many animals might otherwise die from lack of water during the dry season. the location in which the elephants live is an example of a/n and the role they play in creating water holes is an example of a a) ecosystem; habitat b) community; niche c) habitat; niche d) niche; habitat
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 15:30, dogwisperer101
When does a spring tide occur? question 9 options: they occur when the sun, moon, and earth are aligned. in spite of their name, these tides occur twice a year in the spring and fall. they occur on the date of the vernal equinox each year, no matter what stage the moon is in. this is why they are called spring tides. they occur when the sun, moon, and earth are at 45-degree angles from each other. this happens once every spring. they occur when the sun, moon, and earth are aligned. in spite of their name, these tides occur all year long.
Answers: 2
image
Biology, 22.06.2019 19:00, Solany6426
Identify the area on the image where the force of attraction is the strongest.
Answers: 1
Do you know the correct answer?
Which of the following is the correct complementary sequence to the one listed below:
GCAAGT...

Questions in other subjects:

Konu
Mathematics, 13.10.2020 01:01
Konu
Mathematics, 13.10.2020 01:01
Konu
Mathematics, 13.10.2020 01:01
Konu
Health, 13.10.2020 01:01