Select all the correct answers. This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The red letters are the noncoding region, and the black letters are the protein coding region.

ATTAGCATACTACGGGC
ATTTGCATACTGACCGGGC
ATTTGCAATACTACCGGGC
ATTTGCAACTACCGGGC
ATGAATGCATACTACCGGGC

i think its through the fallopian tube

in 1859, charles darwin set out his theory of evolution by natural selection as an explanation for adaptation and speciation. he defined natural selection as the "principle by which each slight variation [of a trait], if useful, is preserved".

brain development. a child's brain undergoes an amazing period of development from birth to three—producing more than a million neural connections each second. the development of the brain is influenced by many factors, including a child's relationships, experiences and environment.

explanation:

the atmospheric gas that forms a mild acid when dissolved in water is called carbon dioxide. the correct answer is a. 2.) chemical weathering would cause an inscription on a marble headstone to become harder and harder to read over time.