Answers: 2
Biology, 21.06.2019 19:00, donuteatingcat
For each of the following, decide whether the statement describes photosynthesis, cellular respiration, or both. releases energy in the form of atp. stores energy in glucose molecules. performed by producers. performed by consumers.
Answers: 1
Biology, 22.06.2019 03:30, sCoTtYbOy5329
What organelle other than the nucleus houses dna in a eukaryotic cell?
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
A chromosomes contains and organic molecule...
History, 08.12.2021 18:40
Advanced Placement (AP), 08.12.2021 18:40
Business, 08.12.2021 18:40
Chemistry, 08.12.2021 18:40
Mathematics, 08.12.2021 18:40
Mathematics, 08.12.2021 18:40
Mathematics, 08.12.2021 18:40