Biology, 18.11.2021 01:00, bestielove7425
2. a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 ZPTTGCATCCGAAACGTACGATCGATCGGCCGACT TATTACGATCGGACTACTGCGTCGTAGC5'... ...5AACGTAGGCTTTGCATGCTAGCTAGCCGGCT GAATAATGCTAGCCTGATCACGCAGCATCG3"... (1) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. (1 mark) (Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i). (1 mark)
Answers: 3
Other questions on the subject: Biology
Biology, 22.06.2019 06:10, thompsonhomes1
The normal shape of an enzyme is as shown in structure a. if the enzyme’s shape changes to that shown in structure b, what are two consequences of this change?
Answers: 1
Biology, 22.06.2019 12:40, seby951
Which of the following best describes the expensive tissue hypothesis? brains require more energy, so the gut had to be reduced, and larger brains and tool use led to higher quality diets. increasing body size means that homo neanderthalensis had to include more fat in its diet. brains require more energy, so the gut had to be reduced as brains got bigger. brains require more fat, so the gastrointestinal viscera (gut) had to expand, and hands were needed to acquire more food.
Answers: 1
Biology, 22.06.2019 14:30, ethanseiter
The lineage of pea plants produced round seeds for four generations. the plants that fertilized these pea plants also produced round seeds. however, in the fifth generation, the plant produced to two plants with wrinkled seeds. can that be possible?
Answers: 2
Do you know the correct answer?
2. a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the...
Questions in other subjects:
Mathematics, 05.05.2020 00:34
History, 05.05.2020 00:34
English, 05.05.2020 00:34
Mathematics, 05.05.2020 00:35
