Biology
Biology, 17.10.2021 07:00, neariah24

Into what body fluids do (a) glucose, (b) fatty acids, glycerol (c) amino acids pass?

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 21.06.2019 21:20, lorielle
How is mitosis different in plants and animals? a. in animals, the cell membrane pinches together. b. in plants, the dna is one circular chromosomes. c. in plants, there are no sister chromatids. d. in animals, a new cell wall forms.
Answers: 2
image
Biology, 21.06.2019 22:10, jakhunter354
Amouse that is homozygous for the dominant trait has the genotype . it has . a mouse that is homozygous for the recessive trait has the genotype . it has . image of fur color of mice
Answers: 1
image
Biology, 22.06.2019 01:20, hannahpelkey
Which organelles are labeled d, and what is one feature that distinguishes them from the other labeled organelles chloroplasts the only organelles that produce sugars from sunlight mosomes, only found in animal and bacterial cells centricles only found in animal cells mitochondra, the only energo-generating structures found in cells
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Into what body fluids do (a) glucose, (b) fatty acids, glycerol (c) amino acids pass?...

Questions in other subjects:

Konu
Mathematics, 03.09.2021 23:20