Biology, 09.10.2021 16:30, tdowling331
Information about the four organisms can be found on the internet. Use credible websites to find answers to the question you developed in part A. Based on this data, draw your own dichotomous key.
Questions I developed in part A:
Is it a unicellular organism?
Is it found inside the human body?
Is it visible without a microscope?
Can it produce its own food?
Can it be used in making food?
Answers: 1
Biology, 21.06.2019 21:30, lkipjjjjjjjjjj5673
What was dr. willem johan kolff’s first step in using the scientific process to invent the hemodialysis machine? he built the machine and tried it with various patients, collecting data about its effectiveness. when a patient’s kidneys failed, he wondered if it would be possible to perform kidney functions with an external machine. he researched and collected data about numerous patients who exhibited symptoms of kidney failure. he drew conclusions from studies of various symptoms of kidney failure, and drew a design for the ideal external blood-processing machine.
Answers: 1
Biology, 22.06.2019 01:00, suselygonza
Which of the following would be a body response when stepping outside without a coat on a snowy day? a. senaceous glands. secrete more senum b. more liquid is transported by the body to the skin fir insulation c. blood vessels in the skin narrow and contract d. blood vessels in the skin expand
Answers: 1
Biology, 22.06.2019 10:00, FailingstudentXD
Dna and rna share a number of similarities, but they also differ in certain aspects of their structure. wich nitrogenous base is found in rna but is not found in dna
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Information about the four organisms can be found on the internet. Use credible websites to find ans...
English, 24.05.2021 09:00
History, 24.05.2021 09:00