![Biology](/tpl/images/cats/biologiya.png)
![answer](/tpl/images/cats/otvet.png)
Answers: 1
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:20, ahmedeldyame
Which of the following statements most accurately describes convergent evolution? the process in which two similar species evolve separately from each other and share similar characteristics the process in which a single species evolves into two or more new species the process in which two entirely different species evolve in response to each other the process in which two different species evolve separately from each other but still share similar characteristics
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:00, FailingstudentXD
Dna and rna share a number of similarities, but they also differ in certain aspects of their structure. wich nitrogenous base is found in rna but is not found in dna
Answers: 1
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
What climate change phenomenon could initiate the slowing of the Gulf Stream current...
Questions in other subjects:
![Konu](/tpl/images/cats/en.png)
English, 11.07.2021 09:40
![Konu](/tpl/images/cats/fizika.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/ekonomika.png)
Business, 11.07.2021 09:50
![Konu](/tpl/images/cats/biologiya.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 11.07.2021 09:50
![Konu](/tpl/images/cats/mat.png)
Mathematics, 11.07.2021 09:50
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 11.07.2021 09:50