What would be the primary structure of this small protein made from the following DNA sequence?
TACTCTGATAATGCCGTCATT

When the cell concentrates potassium within, against the natural tendency of matter, it is performing a. passive diffusion b. facilitated diffusion c. active transport d. pinocytosis

Which series lists the correct order of steps of binary fission from first to last? sex pilus connects two cells ® plasmid dna is transferred ® complementary dna strands are created ® cells separate live cells bind to degraded cells ® dna is transported across the membrane ® dna is incorporated into recipient's dna virus infects bacterial cell, new viruses are made ® dna is assembled in new virus ® new virus infects another bacterial cell and transfers dna dna is copied ® dna molecules attach to cell membrane ® cell membrane elongates and pinches off ® two identical cells are produced

How is geothermal energy transferred from nature to human use?