Biology, 21.09.2021 21:50, destinymitchell966

What would be the primary structure of this small protein made from the following DNA sequence?
TACTCTGATAATGCCGTCATT

What would be the primary structure of this small protein made from the

following DNA sequence?
T

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 05:30, 0prayforthelost0

Which of these is true for bacteria because they are prokaryotic cells? a. they can engulf body cells in order to make memory cells. b. they must invade viruses in order to reproduce. c. they are much larger than eukaryotic body cells. d. they can reproduce on their own outside of other cells.

Answers: 2

continue

Biology, 22.06.2019 13:00, superbatman9193

Which level of taxonomy has the fewest organisms?

Answers: 3

continue

Biology, 22.06.2019 16:00, emilystartk

Hydroelectric uses moving water to do work such as grinding grains in a mill true or false

Answers: 1

continue

Biology, 22.06.2019 17:00, shay8850

First dropdown options: a. runoff b. condensation c. evaporation second dropdown options: a. photosynthesis b. transpiration c. sweating third dropdown options: a. raindrops b. clouds c. animals

Answers: 1

continue

Do you know the correct answer?

What would be the primary structure of this small protein made from the following DNA sequence?