![Biology](/tpl/images/cats/biologiya.png)
Biology, 23.08.2021 06:40, masonbugatti3477
Someone plss help me {no links please} i barely have any points so please only answer if you know
![answer](/tpl/images/cats/otvet.png)
Answers: 3
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:50, jahootey3042
The largest unit within which gene flow can readily occur is a
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 22:00, hunteryolanda82
Which of the following molecules will diffuse most quickly across a lipid bilayer membrane? a. h2o b. o2 c. h2po4 d. glucose e. na+
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Do you know the correct answer?
Someone plss help me {no links please} i barely have any points so please only answer if you know
Questions in other subjects:
![Konu](/tpl/images/cats/es.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 12.02.2021 20:10
![Konu](/tpl/images/cats/istoriya.png)
History, 12.02.2021 20:10
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 12.02.2021 20:10
![Konu](/tpl/images/cats/mat.png)
Mathematics, 12.02.2021 20:10
![Konu](/tpl/images/cats/obshestvoznanie.png)
![Konu](/tpl/images/cats/mat.png)