Transcribe the following gene into mRNA: TACGCGTAATCACGTCCTGTCATC

1. label high-pressure areas with the letter h. 2. label low-pressure areas with the letter l. 3. over which area(s) would you expect to see rain or snow? 4. over which area(s) would you expect to see clear skies? 5. draw arrows around the h on the map to show the wind direction. 6. draw arrows around the l on the map to show the wind direction. 7. imagine that you live in maine. currently there is a high-pressure area over maine. if a low-pressure area moves in, how will the direction of the wind change? 5. draw arrows around the h on the map to show the wind direction. 6. draw arrows around the l on the map to show the wind direction. 7. imagine that you live in maine. currently there is a high-pressure area over maine. if a low-pressure area moves in, how will the direction of the wind change? 8. imagine that you live in colorado. currently there is a low-pressure area over colorado. if a high-pressure area moves in, how will the direction of the wind change? 9. according to the map, where would the strongest winds be expected? (refer to the lesson if needed.)

The skeletal system performs a variety of functions that are crucial to maintaining life processes. what function is performed in the bone marrow, but not in the ossified bones of the skeleton? a oxygen transportation c mineral storage b. muscle attachment d red blood cell production

Which must be kept in mind when determining if an explanation is correct? check all that apply. which must be kept in mind when determining if an explanation is correct? check all that apply.