Biology
Biology, 08.07.2021 15:20, lilzaya510

When an organism encounters nitrate in its environment, which condition will determine whether the nitrate is used in an assimilatory or dissimilatory manner? a. low concentration or ammonia
b. low concentration of sulfate
c. oxygen present
d. low temperature
e. oxygen absent
f. high concentration of nitrite

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 21.06.2019 13:30, samantha636
Heat is the amount of heat required to change the temperature of 1 gram of a substance by 1°c, and it is related to the chemical composition of the substance.
Answers: 1
image
Biology, 22.06.2019 07:00, genesisramirezozfyj7
What molecules will be best used to compare different species with the exact same sequence of amino acids? why would two species have the same protein even if the molecules in question is different? (hint: transcription to translation to protein).
Answers: 1
image
Biology, 22.06.2019 11:30, brebre63
What is the main difference between the central nervous system (cns) and the peripheral nervous system (pns)? .the cns involves the brain and spinal cord, and the pns involves the body nerves. the cns involves the body nerves, and the pns involves the brain and spinal cord. the cns involves sensory neurons, and the pns involves motor neurons. the cns involves motor neurons, and the pns involves sensory neurons.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
When an organism encounters nitrate in its environment, which condition will determine whether the n...

Questions in other subjects:

Konu
Mathematics, 10.02.2021 17:40