Biology
Biology, 16.06.2021 17:10, fionademoss6810

You are a research biologist working at the U. S. research station in Antarctica. You discover a new single-celled organism that is able to survive in the frigid conditions. During your research you observe that the organism has a nucleus. Which domain would this new organism be classified into

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 21.06.2019 16:30, romeojose2005
Dna is always read in the whereas rna is read in .
Answers: 2
image
Biology, 22.06.2019 00:00, mandy9386
The first three phases of the cell cycle are collectively known as (1 point) play audio cellular respiration. telophase. mitosis. interphase.
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 17:00, nehamaan503
What would be he the strand of complementary dna produced be the strand of dna shown below> tcg aag
Answers: 1
Do you know the correct answer?
You are a research biologist working at the U. S. research station in Antarctica. You discover a new...

Questions in other subjects:

Konu
Mathematics, 31.05.2021 14:00
Konu
Computers and Technology, 31.05.2021 14:00