Biology, 11.06.2021 23:40, elizabethluna058

Identify the structures in the cell picture on the right.

Answers: 1

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 17:30, 365371

Charles darwin published his theory of evolution in 1859. in what way foes modern evolutionary theory differ from the theory as proposed by darwin? a) darwin inferred that individuals can evolve, but modern generic science has shown that this is not true. b)darwin inferred that individuals do not evolve, but modern genetic science has shown that this is not true. c)modern science has disproved most of darwin's original theory of evolution, because darwin knew nothing about generations and their role in heredity. d)generic studies have shown that gene expression and other factors operate along with natural selection, but most of darwin's theory has been supported by modern science.

Answers: 1

continue

Biology, 22.06.2019 01:40, warnene17

Elephants in the savanna regions of africa dig holes in dried up river beds to reach water lying just below the surface. these holes provide drinking water for other animals as well. so, without the elephants, many animals might otherwise die from lack of water during the dry season. the location in which the elephants live is an example of a/n and the role they play in creating water holes is an example of a a) ecosystem; habitat b) community; niche c) habitat; niche d) niche; habitat

Answers: 1

continue

Biology, 22.06.2019 06:00, Ryan02717

Sarah and john are having a discussion on genetic diversity. sarah believes that it happen over a long period of time. john it happens immediately. who is correct? a. sarah is correct because genetic diversity occurs over a long period of time. b. john is correct because genetic diversity occurs immediately. c. both are correct because genetic variation can occur or long period of time. d. neither are correct because genetic diversity occurs over any period of time

Answers: 1

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

Do you know the correct answer?

Identify the structures in the cell picture on the right....