Can you please put the steps in the correct order?
...
![answer](/tpl/images/cats/otvet.png)
Answers: 1
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:50, gigimasters71p7tc6l
How do you know that the plant cells in these two images have different jobs, or functions? a. because all plant cells serve different functions b. because they are two different colors c. because their dna are different d. because their structures are different
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:20, DotDotTaterTot
What two factors does carrying capacity compare? population size and resource use population growth and resource availability resource use and time population size and time
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 19:00, unkno
Dr. arenas is a scientist who has been trying to determine if increasing pressure will increase the sound that occurs when two chemicals explode. it measures the volume of the sound that occurs at the minimum pressure at which the explosion will occur. it then increases the pressure and measures the volume of the explosions that occur. what kind of investigation is the scientist conducting?
Answers: 2
Do you know the correct answer?
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/obshestvoznanie.png)
![Konu](/tpl/images/cats/obshestvoznanie.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 15.04.2021 03:10
![Konu](/tpl/images/cats/en.png)
English, 15.04.2021 03:10